Piltdown Hoax

The Piltdown Hoax, was an archeological fraud that took place in the December of 1912. Charles Dawson and Arthur Smith Woodward discovered what they claimed to be a mandible of a human ancestor. This piece was found in an English town named Piltdown. The mandible just showed the lower jawbone and 2 molars. There was no proof of which animal this jawbone may have been from . The claims were that this was the jaw of a human ancestor because of the way the jaw it is shaped, slightly similar to an ape, and because the teeth were similarly shaped and were flattened the way human teeth are due to our diet. The discovery was very abrupt and came from a location were no previous fossils had been found.  Not only this, but following the discovery of the  mandible new fossils were being found in this location in Piltdown. It created an unrest within the scientific population because there was no way to prove that this jaw was really related to humans. Even though there was no way to prove it belonged to the ancestors of humans, it was accepted in terms of the evolution of man at the time. No one was going to come up with an argument against Dawson or Woodward. Forty years later, science had progressed enough to test this finding and see how old it was. The results showed that it was not millions of years old but instead with 100,000 years of range. The bones had been stained, the coloring was not natural. The teeth of the jaw were filed down.  Further testing showed that this jawbone dated within 100 years and belonged to a female orangutan. The parts of the jawbone that would have shown the connection were broken or cut off.  This was very shocking, now the tables had turned to finding out who would create such a hoax.

We as humans have faults. When we make decisions some may be based off of logic others opinions. In this case the creator of this fraud seemed to want to create a name for himself, even if it meant falsifying information. Making rash decisions based off of wants may also lead to a downfall. These types of actions impact the scientific process in major ways. Take for example the Piltdown man, whoever planted the orangutan bone seemed to only be interested in having their name in history. It did not matter to them that it would affect the way evolution of humans was seen and researched. It did not matter that it would scientists in a different direction.

Science benefits us all because no discovery is every left untouched if the resources are not available at the time. Years after the discovery was made new technology created a way to test whether this bone was legitimate. Within the scientific process there are always continuous tests completed when new information is found or when information is lacking. Without these tests and continuous search the fraud of Piltdown man would not have been solved and the evolution of man would have been misleadingly derived.  

I feel as though it is impossible to remove the “human” factor from science. A person can be as detached from their feelings or opinions, yet it is in out nature to behave in certain ways. Reducing the chance of error can only be done by following morals and following the scientific process. If we could remove the human factor from science it may disrupt certain views of theories. Morals and ethics play a big role in observations no matter what the subject in science, without which science would not be the same.

In terms of this historical event, it is a reminder that even if the face value of an unverified discovery or point seem to be correct or substantial there is still a need to find underlying facts to prove the point or discovery. 

Homologous vs. Analogous

Homologous traits are those which are similar based on a descent from a common ancestor. The pelvis of a human which has a coccyx, tailbone(left), is  similar to the pelvis of the monkey with has a tail(right) . The purpose of  a monkey’s tail is to maintain balance or grab onto trees, depending on their  environment. The coccyx in the human, is the remnants of what was a tail and evolved away because humans did not need tails when standing upright.

 The common ancestor of the two is said to be Dryopithecus.  This ancestor can be seen as part of their lineage because the body of this primate matches that of the humans and the monkeys.

Analogous traits are those which are shared only based on a common function, not a common ancestor. The traits which are shared based on common function are the wings of moths and the wings of birds. Both are to create flight for the animals, yet they do not share a common ancestor from who they inherited the ability to fly. The bird wing is constructed on bone, where as the moth wing is constructed of thin layers of chitin, protein. 

 moth wing structure

Birdwing structure

Protein Synthesis

DNA Molecule:

CGGTACTATTGGGTCTTGTAGACAGTAAACGCTAGGTCAATCGGC

Historical Influences on Darwin

Historical Influences on Darwin

Thomas Malthus had the most influence over Darwin’s development of his theory of natural selection. He was a political economist who wrote and discussed in Essay on the Principle of Population  that if man did not control his production of offspring, then there would no food control leading to famine. Malthus’ Essay on the Principle of Population played an important role in Darwin’s discovery of natural selection. Darwin extended Malthus’ observation of animals producing more offspring than can survive onto humans. Transferring this observation helped him recognize that food and environments effect an animal’s survival, and that the animal with the advantageous characteristics will survive and pass them to their offspring.

The point most directly affected by Malthus’ work are 1) resources are limited and 2) organisms with better access to resources will be more successful in their reproductive efforts. These two points are most influenced because they reflect the main point in Malthus’ paper.

Darwin may have been able to develop his theory without Malthus’ paper, yet it would not have happened before Wallace submitted a paper. Darwin’s theory of natural selection was fueled by the concept of Malthus’ paper.

The attitude of the church affected  Darwin in a substantial amount. Not only was Darwin’s wife highly religious and felt his work was against the church. Many of Darwin’s colleagues would have ostracized him for releasing such work. For these reasons Darwin took so long in submitting his work.  

http://www.ucmp.berkeley.edu/history/malthus.html