As is, I believe you made it wrong. I could not come up with any sentence by using these words. if you had provided more subjects, then i possibly would have came up with a sentence.
What you have posted in your comment is correct, but this wasn't the original code that you posted. Both adnan and I attempted to decode the earlier code you posted and it made no sense, possibly because it was missing start/stop codons and I didn't know where to start. For reference, I have posted your original code and my attempt at decoding it below:
I'm glad you were able to make the corrections, but you needed to note that you changed your post so Adnan and I would know to retry it.
DNA: CGGTTATTGGGTCTTGTAGACAGTAAACGCTAGGTCAACCG RNA: GCCAAUAACCCAGAACAUCUGUCAUUUGCGAUCCAGUUGGC Codons: GCC AAU AAC CCA GAA CAU CUG UCA UUU GCG AUC CAG UUG GC (no start codon so we have to start at the beginning) Good animals anthropology sit hungry sleep were and in confusing book eat to GC
As is, I believe you made it wrong. I could not come up with any sentence by using these words. if you had provided more subjects, then i possibly would have came up with a sentence.
ReplyDeleteAdnan, it is still possible to post a string of words that the sentence produces, even if it doesn't make sense. What did you come up with?
DeleteHello Adnan, I'm not sure how you were figuring it out but this is the sentence.
ReplyDeleteTime monster(s) eat anthropology book(s) before sleep(ing) to evolve into ape(s).
CGG= GCC= random code
TAC= AUG= start code
TAT= AUA= time
TGG= ACC= monster
GTC= CAG= eat
TTG= AAC= anthropology
TAG= AUC= book
ACA= UGU= before
GTA= CAU= sleep
AAC= UUG= to
GCT= CGA= evolve
AGG= UCC= into
TCA= AGU= ape
ATC= UAG= stop code
GGC= CCG= random code
What you have posted in your comment is correct, but this wasn't the original code that you posted. Both adnan and I attempted to decode the earlier code you posted and it made no sense, possibly because it was missing start/stop codons and I didn't know where to start. For reference, I have posted your original code and my attempt at decoding it below:
DeleteI'm glad you were able to make the corrections, but you needed to note that you changed your post so Adnan and I would know to retry it.
DNA: CGGTTATTGGGTCTTGTAGACAGTAAACGCTAGGTCAACCG
RNA: GCCAAUAACCCAGAACAUCUGUCAUUUGCGAUCCAGUUGGC
Codons: GCC AAU AAC CCA GAA CAU CUG UCA UUU GCG AUC CAG UUG GC (no start codon so we have to start at the beginning)
Good animals anthropology sit hungry sleep were and in confusing book eat to GC